RE: .NET Crypto Classes Interoperability with Win32 Crypto APIs

From: GPROANO (gproano_at_redmond)
Date: 07/03/03

  • Next message: Jerry Bryant [MSFT]: "Contact Information for Microsoft Security Response Center"
    Date: Thu, 03 Jul 2003 21:32:17 GMT
    
    

    Have you verified that the output file contains the same byte sequence for
    both pieces of your code?

    Guillermo Proano

    This message is provided "AS IS" with no warranties, and confers no rights.
    Any opinions or policies stated within it are my own and do not necessarily
    constitute those of my employer.


  • Next message: Jerry Bryant [MSFT]: "Contact Information for Microsoft Security Response Center"

    Relevant Pages

    • Re: units in [xy]label over variable
      ... It is curious that in your output file, the "A" is not centered under ... However when I run your input script here, ... There is no generic backspace sequence. ... See the output of the "test" command ...
      (comp.graphics.apps.gnuplot)
    • Re: Need help with a program
      ... the sequence has been found in a particular sample). ... TTTTTTTATAAAATATATAGT ... It contains a newbie error (looking for the number 0 instead of the string "0"). ... Just write data to the output file line-by-line. ...
      (comp.lang.python)
    • Help with Application.OnTime
      ... I am writing an Excel macro that has a sequence of 5 tasks to complete. ... Each task is completed by saving a file. ... the second task to start only after the first task's output file has ...
      (microsoft.public.excel.programming)
    • Re: Need help with a program
      ... I will make my question a little more clearer. ... the sequence has been found in a particular sample). ... TTTTTTTATAAAATATATAGT ... what I expect is an output file that is similar ...
      (comp.lang.python)